View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6647_high_12 (Length: 275)
Name: NF6647_high_12
Description: NF6647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6647_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 14 - 147
Target Start/End: Complemental strand, 35202726 - 35202593
Alignment:
| Q |
14 |
cagaagaagaacttgaaactcttgtagaattgaaccttgttgcaaaaggaaagttcatcacatcatgacaagaagagttaccataaagaagagaattgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202726 |
cagaagaagaacttgaaactcttgtagaattgaaccttgttgcaaaaggaaagttcatcacatcatgacaagaagagttaccataaagaagagaattgat |
35202627 |
T |
 |
| Q |
114 |
atggtttgaggtagaagcaatatcaaaactatgg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35202626 |
atggtttgaggtagaagcaatatcaaaactatgg |
35202593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 174 - 259
Target Start/End: Complemental strand, 35202572 - 35202487
Alignment:
| Q |
174 |
agaaggagggtttgaattagcactagtaggagttgaagaagaaggagaagcagtagcagtatcaatatttgaagaggagtgatttg |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35202572 |
agaaggagggtttgaattagcactattaggagttgaagaagaaggagaagcagtagcagtatcaatatttgaagaagagtgatttg |
35202487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University