View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6647_low_6 (Length: 420)
Name: NF6647_low_6
Description: NF6647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6647_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 13 - 403
Target Start/End: Original strand, 29034073 - 29034463
Alignment:
| Q |
13 |
aatattcgggaggagaaagagaataaaccttcaagacaaaaccgggacnnnnnnntaatttttgttccctcaaaatttatttatttttgttggatgaaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29034073 |
aatattcgggaggagaaagagaataaaccttcaaaacaaaaccgggacaaaaaaataatttttgttccctcaaaatttatttatttttgttggatgaaca |
29034172 |
T |
 |
| Q |
113 |
ataattaggcattgaaggacattttcgtcattctaacaaaatctcatcatattttgattactttcataattattttcagtggttgatacgaggtggtcgg |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29034173 |
ataattaggcattgaaggacattctcgtcattctaacaaaatctcatcatattttgattactttcataattattttcagtggttgatacgaggtggtcgg |
29034272 |
T |
 |
| Q |
213 |
tgttaacgtctgtcattttcataccccacaaacatatcaaaaagaccaaaaagtcctatgtaggatacattatccacaaaattcacgtgtaaaattgcat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29034273 |
tgttaacgtctgtcattttcataccccacagacatatcaaaaagaccaaaaagtcctatgtaggatacattatccacaaaattcacgtgtaaaattgcat |
29034372 |
T |
 |
| Q |
313 |
caacggagtaatcgaagattataagaagaataactattttaatgcgtgtcactgaaacaggtttctgggggttttttctggtatccaaatt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29034373 |
caacggagtaatcgaagattataagaagaataactattttaatgcgtgtcactgaaacaggtttctgggggttttttctggtatccaaatt |
29034463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University