View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6648_high_4 (Length: 217)
Name: NF6648_high_4
Description: NF6648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6648_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 43893760 - 43893690
Alignment:
| Q |
1 |
gatggtgaggagtattctagtttttgccttaatttctatgtatgtgagatttccttgttgcaggatgatga |
71 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43893760 |
gatggtgaggagtattctagtttttaccttaatttctatgtatgtgagatttccttgttgcaggatgatga |
43893690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 65 - 199
Target Start/End: Complemental strand, 43893552 - 43893403
Alignment:
| Q |
65 |
atgatgagttattttggtgttttggtactaacaggttggaactttttaattgcttattctcctaccatt---------------ggatcaaatgaaggag |
149 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
43893552 |
atgatgagctattttggtgttttggtactaatgggttggaactttttaattgcttattctcctacctttgaaaaagtgcaataaggatcaaaagaaggac |
43893453 |
T |
 |
| Q |
150 |
ctaaggaacatatatcctaattaattgctactggtttgttgcagatgtat |
199 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43893452 |
ctaaggaacacatatcctaattagtggctactggtttgttgcagatgtat |
43893403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 65 - 197
Target Start/End: Complemental strand, 44303216 - 44303069
Alignment:
| Q |
65 |
atgatgagttattttggtgttttggtactaacaggttggaactttttaattgcttattctcctaccatt---------------ggatcaaatgaaggag |
149 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||| |||||| |
|
|
| T |
44303216 |
atgatgagctattttggtgttttggtactaatgggttggaactttttaattgcttattctcctacctttgaaaaagtgcaataaggatcaatagaaggac |
44303117 |
T |
 |
| Q |
150 |
ctaaggaacatatatcctaattaattgctactggtttgttgcagatgt |
197 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44303116 |
ctaaggaacacatatcctaattagttgctactggtttgttgcagatgt |
44303069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 44303418 - 44303347
Alignment:
| Q |
5 |
gtgaggagtattctagtttttgccttaatttctatgtatgtgagatttccttgttgcaggatgatgagttattt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
44303418 |
gtgaggagtattctagtttttgccttaatttctatgta--tgagatttccttgttgcaggatgatgagctattt |
44303347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 44294556 - 44294505
Alignment:
| Q |
1 |
gatggtgaggagtattctagtttttgccttaatttctatgtatgtgagattt |
52 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44294556 |
gatggtgaagagtattctagtttttacattaatttctatgtatgtgagattt |
44294505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 44294379 - 44294316
Alignment:
| Q |
65 |
atgatgagttattttggtgttttggtactaacaggttggaactttttaattgcttattctcctac |
129 |
Q |
| |
|
||||| || ||||||||||||| |||||||| |||| | | ||||||||||||||||||| |||| |
|
|
| T |
44294379 |
atgataagctattttggtgttt-ggtactaataggtcgtagctttttaattgcttattctactac |
44294316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University