View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_high_11 (Length: 399)
Name: NF6649_high_11
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 22 - 132
Target Start/End: Complemental strand, 17379876 - 17379766
Alignment:
| Q |
22 |
gactattaatctgtctccaccttagaagacaatgttaacttgcgttattgattgttttttggttatattagtctgctgataattttttatggaataatta |
121 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17379876 |
gactattaatctctctataccttagaagacaatgttaacttgcgttattgattgttttttggttatattagtctgatgataattttttatggaataatta |
17379777 |
T |
 |
| Q |
122 |
attttgtttag |
132 |
Q |
| |
|
||||||||||| |
|
|
| T |
17379776 |
attttgtttag |
17379766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 17398900 - 17398821
Alignment:
| Q |
100 |
ataattttttatggaataattaattttgtttagcatgatgagaaaaggcttttatttctctttgttatccccattatgag |
179 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||| ||| |||||||||||||||||| | |||||||| |
|
|
| T |
17398900 |
ataattttttgtggaataatttcttttgtttagcatgatggcaaaaagctcttatttctctttgttatctcaattatgag |
17398821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 107
Target Start/End: Complemental strand, 17395314 - 17395245
Alignment:
| Q |
38 |
ccaccttagaagacaatgttaacttgcgttattgattgttttttggttatattagtctgctgataatttt |
107 |
Q |
| |
|
||||||||||||| | |||||||||||| ||||||||||| |||| |||||||||| |||| |||||||| |
|
|
| T |
17395314 |
ccaccttagaagaaactgttaacttgcgctattgattgttatttgattatattagtttgctaataatttt |
17395245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 166
Target Start/End: Complemental strand, 4816584 - 4816540
Alignment:
| Q |
122 |
attttgtttagcatgatgagaaaaggcttttatttctctttgtta |
166 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
4816584 |
attttgtttagcatgatgccaaaaggctcttatttctctttgtta |
4816540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University