View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_high_31 (Length: 245)
Name: NF6649_high_31
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 41151185 - 41151414
Alignment:
| Q |
1 |
ttccactttagttttaagtaaaatacggtaccctacatctatttaatgctctgtttgtatttttcttcaatttgaagttaaagataccctatgaatggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41151185 |
ttccactttagttttaagtaaaatacggtaccctacatctatttaatgctctgtttgtatttttcttcaatttgaagttaaagataccctatgaatggtg |
41151284 |
T |
 |
| Q |
101 |
atgaattgaaccaacttaaccaagcaagaatgtacaatgaggtagacgtggcggattatcattggtagtgttcgtaaatggcttgatacccttacta-ta |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||| || |
|
|
| T |
41151285 |
atgaattgaaccaacttaaccaagaaagaatgtacaatgaggtagacgtagcggattatcattggtagtgttagtaaatggcttgatacccctactacta |
41151384 |
T |
 |
| Q |
200 |
tgggactgttggtccattttatatgacact |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41151385 |
tgggactgttggtccattttatatgacact |
41151414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University