View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6649_low_12 (Length: 399)

Name: NF6649_low_12
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6649_low_12
NF6649_low_12
[»] chr5 (4 HSPs)
chr5 (22-132)||(17379766-17379876)
chr5 (100-179)||(17398821-17398900)
chr5 (38-107)||(17395245-17395314)
chr5 (122-166)||(4816540-4816584)


Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 22 - 132
Target Start/End: Complemental strand, 17379876 - 17379766
Alignment:
22 gactattaatctgtctccaccttagaagacaatgttaacttgcgttattgattgttttttggttatattagtctgctgataattttttatggaataatta 121  Q
    |||||||||||| |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
17379876 gactattaatctctctataccttagaagacaatgttaacttgcgttattgattgttttttggttatattagtctgatgataattttttatggaataatta 17379777  T
122 attttgtttag 132  Q
    |||||||||||    
17379776 attttgtttag 17379766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 17398900 - 17398821
Alignment:
100 ataattttttatggaataattaattttgtttagcatgatgagaaaaggcttttatttctctttgttatccccattatgag 179  Q
    |||||||||| ||||||||||  |||||||||||||||||  |||| ||| |||||||||||||||||| | ||||||||    
17398900 ataattttttgtggaataatttcttttgtttagcatgatggcaaaaagctcttatttctctttgttatctcaattatgag 17398821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 107
Target Start/End: Complemental strand, 17395314 - 17395245
Alignment:
38 ccaccttagaagacaatgttaacttgcgttattgattgttttttggttatattagtctgctgataatttt 107  Q
    ||||||||||||| | |||||||||||| ||||||||||| |||| |||||||||| |||| ||||||||    
17395314 ccaccttagaagaaactgttaacttgcgctattgattgttatttgattatattagtttgctaataatttt 17395245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 166
Target Start/End: Complemental strand, 4816584 - 4816540
Alignment:
122 attttgtttagcatgatgagaaaaggcttttatttctctttgtta 166  Q
    ||||||||||||||||||  |||||||| ||||||||||||||||    
4816584 attttgtttagcatgatgccaaaaggctcttatttctctttgtta 4816540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University