View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_low_15 (Length: 342)
Name: NF6649_low_15
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 143 - 325
Target Start/End: Original strand, 55383522 - 55383704
Alignment:
| Q |
143 |
tgtaacatgattataaaaaatatatatatagacagcctgatcaaaaggtgtgttctgtaaatagaaggacccagttgacaaggatatgtgtatgactttg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55383522 |
tgtaacatgattataaaaaatatatatatagacagcctgatcaaaaggtgtgttctgtaaatagaaggacccagttgacaaggatatgtctatgactttg |
55383621 |
T |
|
| Q |
243 |
gcaaatgtatatgcctactcaactcaattatactacacagccaaccgtatcattcaaatcagcaacaaaatcacaaacacttg |
325 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383622 |
gcaaatgtatatgcctactcaacccaattatactacacagccaaccgtatcattcaaatcagcaacaaaatcacaaacacttg |
55383704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 74 - 150
Target Start/End: Original strand, 55383422 - 55383498
Alignment:
| Q |
74 |
tacattgtgtatccaacaattttcccgacaaacattaatgacggcaaacaatagttgatatttcgtgcctgtaacat |
150 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55383422 |
tacattgtgtatccaacatttttcccgacaaacattaatgacggcaaacaatagttgatatttcgtgcctataacat |
55383498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 55383355 - 55383390
Alignment:
| Q |
9 |
aaatggatagagagtcgatttctgactcttacatat |
44 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55383355 |
aaatggttagagagtcgatttctgactcttacatat |
55383390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University