View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_low_18 (Length: 310)
Name: NF6649_low_18
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 7446474 - 7446676
Alignment:
| Q |
1 |
actatagtgttttgtttttatttgtctcaacacaacagcagtaacgtcaatttagggcaagcatgttaccatgtttcttctctggtggtcttgatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7446474 |
actatagtgttttgtttttatttgtctcaacacaacaccagtaacgtcaatttagggcaagcatgttaccatgtttcttctctggtggtcttgatatttt |
7446573 |
T |
|
| Q |
101 |
ttctattctcgtttagctctaaaaaagttgtttgcttagtttaatccactaaatgttgttgatagagagaagaaacactagcatgcaaccggttctttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7446574 |
ttctattctcgtttagctctaaaaaagttgtttgcttagtttaatccactaaatgttgttgatagagagaagaaacactagcatgcaaccggttctttag |
7446673 |
T |
|
| Q |
201 |
gac |
203 |
Q |
| |
|
||| |
|
|
| T |
7446674 |
gac |
7446676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 7461462 - 7461569
Alignment:
| Q |
1 |
actatagtgttttgtttttatttgtctcaacacaacagcagtaacgtcaatttagggcaagcatgttaccatgtttcttctctggtggtcttgatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7461462 |
actatagtgttttgtttttatttgtatcaacacaacactagtaacgtcaatttagggcaagcatgctaccatgtttcttctctggtggtcttgatttttt |
7461561 |
T |
|
| Q |
101 |
ttctattc |
108 |
Q |
| |
|
|| ||||| |
|
|
| T |
7461562 |
ttttattc |
7461569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 120 - 203
Target Start/End: Original strand, 7461594 - 7461674
Alignment:
| Q |
120 |
taaaaaagttgtttgcttagtttaatccactaaatgttgttgatagagagaagaaacactagcatgcaaccggttctttaggac |
203 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||||| |||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
7461594 |
taaaaaagttgtttgcttagtttaataccctaaa---tgttgaaagagagaataggcactagcatgcaacgagttctttaggac |
7461674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University