View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_low_23 (Length: 262)
Name: NF6649_low_23
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 160
Target Start/End: Complemental strand, 46796500 - 46796344
Alignment:
| Q |
3 |
atggtggcagtcaaccaactacaatatcatttcaatttattaa-aaaattatatctcgatttgtttagccgttnnnnnnnncaaaattgttttcccatta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46796500 |
atggtggcagtcaaccaactacaatatcatttcaatttattaaaaaaattatatctcgatttgtttagccgttaaaaa----aaaattgttttcccatta |
46796405 |
T |
 |
| Q |
102 |
tatgattaaaaagtatgtgtgtcc--nnnnnnnnaggggaagtatgtgtgtccttgtaccc |
160 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46796404 |
tatgattaaaaagtatgtgtgtccttttttttttaggggaagtatgtgtgtccttgtaccc |
46796344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 46796305 - 46796253
Alignment:
| Q |
199 |
gtatgtgtacttttgatcaattatatgatgtggtgatatacttgagctatatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46796305 |
gtatgtgtacttttgatcaattatatgatgtggtgatatacttgggctatatt |
46796253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University