View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_low_28 (Length: 252)
Name: NF6649_low_28
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 6194541 - 6194783
Alignment:
| Q |
1 |
cctgccctacacgaattttactggatttgaggaagatagattcatctatcttatattccgactgttttggattcgtgtcgtt-ctcagttccagctatag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||| |||||| |
|
|
| T |
6194541 |
cctgccctacacgaattttactggatttgaggaagatagattcatctatcttatattccgactgttttggattcgtgtgtatgcttcattcg-gctataa |
6194639 |
T |
|
| Q |
100 |
agagttcgacttcttgtcgttctcagttaacaacttaaatatttttaggtttaaactagttattaagaatccctct---taatcgtggagtgtagttgat |
196 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
6194640 |
agagttcggcttcttgtcgttctcacttaacaacttaaatatttttaggtttaaactagttattaagaatccctcttaataatcgtgaagtgtagttgat |
6194739 |
T |
|
| Q |
197 |
atcaataaaattttgcagcataaattttttggtttgatgatatt |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6194740 |
atcaataaaactttgcagcataaattttttggtttgatgatatt |
6194783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University