View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_low_31 (Length: 245)
Name: NF6649_low_31
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_low_31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 94 - 245
Target Start/End: Complemental strand, 29925179 - 29925026
Alignment:
| Q |
94 |
gtcgttttcataaataaattaatatacttgcataaactattttgttacacaagcactttttt--atggataattatataacaatttattggataatatca |
191 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29925179 |
gtcgttttcttaaataaattaatatacttgcataaactattttgttacacaagcacttttttttatggataattatataacaatttattggataatatca |
29925080 |
T |
|
| Q |
192 |
tatttaacttcttatatatgcaaatcatctcaacttatcgatatatatttcttt |
245 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29925079 |
tatttaacttcttacatatgcaaatcatatcaacttatcgatatatatttcttt |
29925026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University