View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6649_low_35 (Length: 237)
Name: NF6649_low_35
Description: NF6649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6649_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 24001859 - 24002011
Alignment:
| Q |
1 |
atattgttggtttgctctttctacttcttttttgatttgttctttatggatcttttaatttcttaatagaaatcattacttggttttaatttcatgttac |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24001859 |
atattgttgttttgctctttctacttcttttttgatttgttctttatggatcttttaatttcttaatagaaatcattacttggttttaatttcatgttac |
24001958 |
T |
 |
| Q |
101 |
cctttatagattatattatcaaccaaaacaaagttatttataggcttccgttt |
153 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24001959 |
cctttatagataatattgtcaaccaaaacaaagttatttataggcttccgttt |
24002011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 23962230 - 23962088
Alignment:
| Q |
1 |
atattgttggtttgctctttctacttcttttttgatttgttctttatggatcttttaatttcttaatagaaatcattacttggttttaatttcatgttac |
100 |
Q |
| |
|
||||||||| |||| |||| |||||||| ||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23962230 |
atattgttgctttggtcttcctacttctattttgatttgtgctccatggatcttttaatttcttaatagaaatttttacttggttttaatttcatgttac |
23962131 |
T |
 |
| Q |
101 |
cctttatagattatattatcaaccaaaacaaa-gttatttata |
142 |
Q |
| |
|
||||||| |||||||| |||| |||| ||| |||||||||| |
|
|
| T |
23962130 |
cctttattagttatattagcaactaaaaaaaaggttatttata |
23962088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University