View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6650_high_5 (Length: 285)
Name: NF6650_high_5
Description: NF6650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6650_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 83 - 271
Target Start/End: Original strand, 3599679 - 3599867
Alignment:
| Q |
83 |
aaaattcatatttaagtcatagaaggtaattgaaatcttaccggtaaaggagagtcaatgtccttgaaatgaccatgagccctctgaatatcaacaggat |
182 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||| || |||||||||||||| ||||| || |||||| ||||||||| ||| || ||||||| |
|
|
| T |
3599679 |
aaaattcatacttaggtcatagatggtaattgaaatcttactggcaaaggagagtcaatatccttcaactgaccaagagccctcttaatctctacaggat |
3599778 |
T |
 |
| Q |
183 |
taagggctgcagccacaaccttgatgagcacttgatcttctttggggtgtggtgtaggtacattaggatcaaactttagaatatcttct |
271 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3599779 |
taagggcagcagccacaaccttgatgagcacttgatcttctttggggtgtggtgtaggtacattaggatcaaactttagaacatcttct |
3599867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 92 - 271
Target Start/End: Original strand, 3603800 - 3603979
Alignment:
| Q |
92 |
atttaagtcatagaaggtaattgaaatcttaccggtaaaggagagtcaatgtccttgaaatgaccatgagccctctgaatatcaacaggattaagggctg |
191 |
Q |
| |
|
|||||||||||||| || ||| |||| |||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| | |
|
|
| T |
3603800 |
atttaagtcatagatggcaatagaaaccttaccggcaaaggagagtcaatgtccttgaaatgaccaagagccctcttaatatcaacaggattaagggcag |
3603899 |
T |
 |
| Q |
192 |
cagccacaaccttgatgagcacttgatcttctttggggtgtggtgtaggtacattaggatcaaactttagaatatcttct |
271 |
Q |
| |
|
|||| || |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
3603900 |
cagcaaccaccttgatgagcacttgatcttcttttgggtgtggtgtaggtacattagaatcaaactttagaatctcttct |
3603979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 226
Target Start/End: Original strand, 14365274 - 14365328
Alignment:
| Q |
172 |
atcaacaggattaagggctgcagccacaaccttgatgagcacttgatcttctttg |
226 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
14365274 |
atcaacaggattaagggaagcagcaacaaccttgatgaggacttgatcatctttg |
14365328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University