View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6650_low_4 (Length: 382)
Name: NF6650_low_4
Description: NF6650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6650_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 63 - 263
Target Start/End: Complemental strand, 40116090 - 40115888
Alignment:
| Q |
63 |
cttcagaataatatcaaatctcagcatcactgtataccctcaacaattaattcccattatggcagtatctcagttagcagcttcatatgctgctgtagta |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40116090 |
cttcagaataatatcaaatctcagcatcactgtataccctcaacaattaattcccattatggcagtatctcagttagcagcttcatatgctgctgtagta |
40115991 |
T |
 |
| Q |
163 |
cttggtaggacaccgcttatgacttatcgatcatgaattcaaaaataagtctgtttcataaataatg--nnnnnnnttaaatgtcatttgttaaaatagt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40115990 |
cttggtaggacaccgcttatgacttatcgatcatgaattcaaaaataagtctgtttcataaataatgaaaaaaaaattaaatgtcatttgttaaaatagt |
40115891 |
T |
 |
| Q |
261 |
tgg |
263 |
Q |
| |
|
||| |
|
|
| T |
40115890 |
tgg |
40115888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University