View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6650_low_5 (Length: 337)
Name: NF6650_low_5
Description: NF6650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6650_low_5 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0264 (1 HSPs) |
 |  |  |
|
| [»] scaffold0206 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0190 (1 HSPs) |
 |  |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 22)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 223 - 320
Target Start/End: Original strand, 33592855 - 33592952
Alignment:
| Q |
223 |
ctaagtacatgtttgcttctgtgttatacaaaccacgttttccataaaatcacacaactcacacgttaacgcaaaagcttcaaatgctagcttatact |
320 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33592855 |
ctaagtacatgtttgcttctgcgttatacaaaccacgttttccataaaatcacacaactcacatgttaacgcaaaagcttcaaatgctagcttatact |
33592952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 223 - 320
Target Start/End: Original strand, 33599986 - 33600083
Alignment:
| Q |
223 |
ctaagtacatgtttgcttctgtgttatacaaaccacgttttccataaaatcacacaactcacacgttaacgcaaaagcttcaaatgctagcttatact |
320 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33599986 |
ctaagtacatgtttgcttctgcgttatacaaaccacgttttccataaaatcacacaactcacatgttaacgcaaaagcttcaaatgctagcttatact |
33600083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 33585864 - 33585960
Alignment:
| Q |
223 |
ctaagtacatgtttgcttctgtgttatacaaaccacgttttccataaaatcacacaactca-cacgttaacgcaaaagcttcaaatgctagcttata |
318 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| | ||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
33585864 |
ctaagtacatgtttgcttctacgttttacaaaccacgttttccataataccacacaactcaccaagttaacgcaaaagcttcaaacgctagcttata |
33585960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 82 - 141
Target Start/End: Original strand, 33592786 - 33592845
Alignment:
| Q |
82 |
aatgactaattctctctcttcgtcattgtcataacacacattcttggaattatattttaa |
141 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33592786 |
aatgactaattctctctcttcgtcagtgtcataacatacattcttggaattatattttaa |
33592845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 82 - 141
Target Start/End: Original strand, 33599917 - 33599976
Alignment:
| Q |
82 |
aatgactaattctctctcttcgtcattgtcataacacacattcttggaattatattttaa |
141 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33599917 |
aatgactaattctctctcttcgtcagtgtcataacatacattcttggaattatattttaa |
33599976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 52246582 - 52246630
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
52246582 |
gggaaatgctaactggtgcctccggggcactggttaaggatatgaaaaa |
52246630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 4168183 - 4168232
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4168183 |
gggaaatgctaaccggtgcctccggggaactggttaaggatataaaaaag |
4168232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 18014670 - 18014721
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| |||||||||| |||||| |
|
|
| T |
18014670 |
aagggaaatgctaactggtgcccccggggcactgattaaggatatgaaaaag |
18014721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 46352632 - 46352683
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
46352632 |
aagggaaatgctaaccggtgcccccggggcactggttaaggatatgaaaaag |
46352683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 272219 - 272269
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
272219 |
agggaaatgctaaccggtgcccccggggcactggttaaggatatgaaaaag |
272269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 41304004 - 41304054
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||| |||||| |
|
|
| T |
41304004 |
agggaaatgctaaccggtgcctccggggcagtggttaaggatatgaaaaag |
41304054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 49893330 - 49893380
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
49893330 |
agggaaatgctaaccggtgcccccggggcactggttaaggatatgaaaaag |
49893380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 43786863 - 43786920
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| |||||||||| | ||| |||||| |
|
|
| T |
43786863 |
tattttatgggaaatgctaaccggtgcctccggggcactggttaatggtatgaaaaag |
43786920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 28139309 - 28139357
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
28139309 |
gggaaatgctaactggtgcccccaagacactggttaaggatatgaaaaa |
28139357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 143 - 190
Target Start/End: Complemental strand, 42964434 - 42964387
Alignment:
| Q |
143 |
ggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||||||||| ||||| |
|
|
| T |
42964434 |
ggaaatgttaactggtgcttccggggcactggttaaggatatgaaaaa |
42964387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 52520679 - 52520730
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
52520679 |
aagggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
52520730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 190
Target Start/End: Complemental strand, 40362768 - 40362718
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
40362768 |
aagggaaatgctaacccgtgcctccggggcactgattaaggatatgaaaaa |
40362718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 48725266 - 48725320
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||| ||||||||||||| |||||| | ||| |||||||||||||||| |||||| |
|
|
| T |
48725266 |
tttatgggaaatgctaaccggtgccccgggggcactggttaaggatatgaaaaag |
48725320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 20923992 - 20924041
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||||||| ||| |||||| |
|
|
| T |
20923992 |
gggaaatgctaaccggtgcttccggggcactggttaagggtatgaaaaag |
20924041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 23925280 - 23925329
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||||| ||||||||||| |
|
|
| T |
23925280 |
gggaaatgctaactggtacccccggggaactggttaagaatataaaaaag |
23925329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 39074419 - 39074468
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
39074419 |
gggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
39074468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 50395742 - 50395698
Alignment:
| Q |
148 |
tgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
50395742 |
tgctaaccggtgcccccgggacactggttagggatatgaaaaaga |
50395698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 23402135 - 23402187
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
23402135 |
taagggaaatgctaactggtgcctccggggcactggttaaggatatgaaaaag |
23402187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 20897942 - 20897997
Alignment:
| Q |
136 |
ttttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||| |||||| || || |||||||||||||||| |||||| |
|
|
| T |
20897942 |
ttttaagggaaatgctaaccggtgcccccagggcactggttaaggatatgaaaaag |
20897997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 29451301 - 29451252
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
29451301 |
agggaaatgctaactggtgcctccggg-caccggttaaggatatgaaaaag |
29451252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 28225221 - 28225270
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||||||| |||| || |||||||||||| |||||| |
|
|
| T |
28225221 |
gggaaatgctaactggtgcctctgggatacgggttaaggatatgaaaaag |
28225270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 34712312 - 34712271
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
34712312 |
gggaaatgctaaccggtgcctccggggcactggttaaggata |
34712271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 192
Target Start/End: Complemental strand, 7851347 - 7851295
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||||||||||||| |||||| || || |||||||||||||||| ||||||| |
|
|
| T |
7851347 |
aagggaaatgctaaccggtgcccccagggcactggttaaggatatgaaaaaga |
7851295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 191
Target Start/End: Original strand, 12525712 - 12525768
Alignment:
| Q |
135 |
attttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
12525712 |
atttaaagggaaatgctaaccggtgcctccggggtactggttaagggtatgaaaaag |
12525768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 34396716 - 34396664
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||| |||||| || |||||| |||||||||||| |||||| |
|
|
| T |
34396716 |
taagggaaatgctaaccggtgcccccaggacacaggttaaggatatgaaaaag |
34396664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 35043890 - 35043938
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
35043890 |
gggaaatgctaactggtgtccacgggacactggttaaggatatgaaaaa |
35043938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 132 - 191
Target Start/End: Original strand, 3515756 - 3515815
Alignment:
| Q |
132 |
tatattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||| ||||||||||||||| |||||| || || |||||||||||| ||| |||||| |
|
|
| T |
3515756 |
tatatttaaagggaaatgctaaccggtgcccccagggcactggttaagggtatgaaaaag |
3515815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 392091 - 392145
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
392091 |
tttatgggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
392145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 2350643 - 2350701
Alignment:
| Q |
133 |
atattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||| | ||||||||||| ||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
2350643 |
atattttatgtgaaatgctaaccggtgctcccggggcactggttaaggatatgaaaaag |
2350701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 13529454 - 13529504
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||||||||| | |||||| |
|
|
| T |
13529454 |
agggaaatgctaacttgtgccttcggggcactggttaaggatgtgaaaaag |
13529504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 27433491 - 27433541
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
27433491 |
agggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
27433541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 21878533 - 21878484
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| ||||||||| || ||| |||||||||||| |||||| |
|
|
| T |
21878533 |
gggaaatgctaaccggtgcctcccgggcacgggttaaggatatgaaaaag |
21878484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 29978233 - 29978281
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| ||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
29978233 |
gggaaatgctaaccggtgcctcc-ggacactagttaaggatatgaaaaag |
29978281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 5694313 - 5694368
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaa |
189 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5694313 |
tattttatgggaaatgctaaccggtgcctccggggcactggttaaggatataaaaa |
5694368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 18043160 - 18043211
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
18043160 |
aagggaaatgctaaccggtgcctccggggcactggttaagggtataaaaaag |
18043211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 29657770 - 29657820
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
29657770 |
agggaaatgctaaccggtgcccccggggcactggttaaggatataaaaaag |
29657820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 51065936 - 51065885
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||||||||||||| |||||| |
|
|
| T |
51065936 |
aagggaaatgctaaccggtgtccccgggacactggttaaggatatgaaaaag |
51065885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 138 - 191
Target Start/End: Complemental strand, 28726096 - 28726042
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaaggat-ataaaaaag |
191 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
28726096 |
ttaagggaaatgctaaccggtgcccccggggcactggttaaggataataaaaaag |
28726042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 29210412 - 29210462
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
29210412 |
agggaaatgctaaccggtgcctccggggcactggttaagggtatgaaaaag |
29210462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 190
Target Start/End: Original strand, 29683193 - 29683243
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
29683193 |
aagggaaatgctaaccggtgcccccggggcactggttaaagatataaaaaa |
29683243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 13961211 - 13961260
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||| |||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
13961211 |
agggaaatgctaaccggtgcccccggggcacgggttaaggatataaaaaa |
13961260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 38162844 - 38162900
Alignment:
| Q |
136 |
ttttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||| |||||||| |||| |||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
38162844 |
ttttatgggaaatgttaaccggtgcctccggggcactggttaagggtatgaaaaaga |
38162900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 42770181 - 42770127
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||||| | ||| |||||| |
|
|
| T |
42770181 |
tttaagggaaatgctaaccggtgcccccggggcactggttaatggtatgaaaaag |
42770127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 12377219 - 12377252
Alignment:
| Q |
148 |
tgctaactggtgcctccgggacactggttaagga |
181 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
12377219 |
tgctaaccggtgcctccgggacactggttaagga |
12377252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 138 - 191
Target Start/End: Original strand, 15227735 - 15227788
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||| ||| || | ||| |||||||||||||||| |||||| |
|
|
| T |
15227735 |
ttaagggaaatgctaaccggtaccccgggggcactggttaaggatatgaaaaag |
15227788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 17333467 - 17333419
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
17333467 |
gggaaatgctaaccggtgcccccggg-cactggttaaggatatgaaaaag |
17333419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 24178649 - 24178600
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| | |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
24178649 |
gggaaatgctaaccgatgcccccggggcactggttaaggatatgaaaaag |
24178600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 38595939 - 38595898
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
38595939 |
gggaaatgctaaccggtgcccccggggcactggttaaggata |
38595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 20)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 138 - 188
Target Start/End: Complemental strand, 4537934 - 4537884
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaa |
188 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
4537934 |
ttaagggaaatgctaaccggtgcctccggggcactggttaaggatataaaa |
4537884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 11112638 - 11112688
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11112638 |
agggaaatgctaactggtgcatccgggacactggttaaggatatgaaaaag |
11112688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 27988687 - 27988636
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
27988687 |
aagggaaatgctaaccggtgcctccggggcactggttaaggatatgaaaaag |
27988636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 28045989 - 28045938
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
28045989 |
aagggaaatgctaaccggtgcctccggggcactggttaaggatatgaaaaag |
28045938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 2490386 - 2490334
Alignment:
| Q |
131 |
ttatattttaagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
2490386 |
ttattttttaagggaaatgctaaccggtgcctccggggcacaggttaaggata |
2490334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 9278209 - 9278261
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||| ||||| |||||| |
|
|
| T |
9278209 |
taagggaaatgctaactggtgcctcagggacactcgttaaagatatgaaaaag |
9278261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 33357318 - 33357266
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
33357318 |
taagggaaatgctaactggtgcccccggagcactggttaaggatatgaaaaag |
33357266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 168464 - 168515
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
168464 |
aagggaaatgctaaccggtgcctccggggcactggttaagggtatgaaaaag |
168515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 144 - 191
Target Start/End: Complemental strand, 20831737 - 20831690
Alignment:
| Q |
144 |
gaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
20831737 |
gaaatgctaaccggtgcccccgggacactggttaaggatatgaaaaag |
20831690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 191
Target Start/End: Complemental strand, 30675766 - 30675709
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
30675766 |
tattttatgggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
30675709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 135 - 190
Target Start/End: Original strand, 16785080 - 16785134
Alignment:
| Q |
135 |
attttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||||||||| |||| |||| || |||||||||||||||| ||||| |
|
|
| T |
16785080 |
attttaagggaaatgctaaccggtg-ctccagggcactggttaaggatatgaaaaa |
16785134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 192
Target Start/End: Complemental strand, 16394247 - 16394197
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||||||||| | ||||||| |
|
|
| T |
16394247 |
gggaaatgctaaccggtgcccccggggcactggttaaggatgtgaaaaaga |
16394197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 133 - 183
Target Start/End: Complemental strand, 39751667 - 39751617
Alignment:
| Q |
133 |
atattttaagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
|||| ||| ||||||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
39751667 |
atatattatgggaaatgctaaccggtgcccccggggcactggttaaggata |
39751617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 2805446 - 2805397
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||||||||||| |||||| |
|
|
| T |
2805446 |
gggaaatgttaaccagtgcccccgggacactggttaaggatatgaaaaag |
2805397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 13643004 - 13643053
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||| |||| |||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
13643004 |
tatttaaaggaaaatgctaaccggtgcccccggggcactggttaaggata |
13643053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 13743429 - 13743478
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||| |||| |||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
13743429 |
tatttaaaggaaaatgctaaccggtgcccccggggcactggttaaggata |
13743478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 34228682 - 34228731
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| | ||| |||||||||||||||| |||||| |
|
|
| T |
34228682 |
gggaaatgctaaccggtgccccgggggcactggttaaggatatgaaaaag |
34228731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 37373206 - 37373254
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
37373206 |
gggaaatgctaaccggtgcccccgg-acactggttaaggatatgaaaaag |
37373254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 144 - 180
Target Start/End: Original strand, 7261954 - 7261990
Alignment:
| Q |
144 |
gaaatgctaactggtgcctccgggacactggttaagg |
180 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7261954 |
gaaatgttaaccggtgcctccgggacactggttaagg |
7261990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 10618012 - 10618068
Alignment:
| Q |
136 |
ttttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
|||||||| |||||||||| |||||||| || ||| |||||||||||| ||||||| |
|
|
| T |
10618012 |
ttttaaggaaaatgctaaccggtgcctctagggcacaggttaaggatatgaaaaaga |
10618068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 20)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 32217040 - 32217094
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32217040 |
tttatgggaaatgctaactggtgcccccggggcactggttaaggatataaaaaag |
32217094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 43944504 - 43944556
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
43944504 |
taagggaaatgctaaccggtgcctccggggcactggttaagggtatgaaaaag |
43944556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 134 - 190
Target Start/End: Complemental strand, 46688404 - 46688348
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| | |||||||||||||||| ||||| |
|
|
| T |
46688404 |
tattataagggaaatgctaactggtgcccccgaggcactggttaaggatatgaaaaa |
46688348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 183
Target Start/End: Complemental strand, 10110189 - 10110147
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
10110189 |
agggaaatgctaaccggtgcctccgggacactgattaaggata |
10110147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 137 - 193
Target Start/End: Complemental strand, 16572679 - 16572623
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaagag |
193 |
Q |
| |
|
||||||| |||||||||| |||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
16572679 |
tttaaggaaaatgctaaccggtgcctccgaggcactggttaaggataataaaaagag |
16572623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 184
Target Start/End: Original strand, 29591187 - 29591231
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatat |
184 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
29591187 |
aagggaaatgctaactggtgcccccggggcactggttaagaatat |
29591231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 15186241 - 15186292
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
15186241 |
aagggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
15186292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 144 - 183
Target Start/End: Complemental strand, 22225930 - 22225891
Alignment:
| Q |
144 |
gaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
22225930 |
gaaatgctaaccggtgcccccgggacactggttaaggata |
22225891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 43202575 - 43202520
Alignment:
| Q |
136 |
ttttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||| ||||||| ||| |||||| |
|
|
| T |
43202575 |
ttttaagggaaatgctaaccggtgcccccggggcactagttaagggtatgaaaaag |
43202520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 52533973 - 52533922
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
52533973 |
aagggaaatgttaaccggtgcctccaggacactggttaagaatatgaaaaag |
52533922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 4269009 - 4268959
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
4269009 |
agggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
4268959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 18068066 - 18068016
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
18068066 |
agggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
18068016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 184
Target Start/End: Original strand, 54897308 - 54897350
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatat |
184 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
54897308 |
gggaaatgctaaccggtgcccccggggcactggttaaggatat |
54897350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 12701958 - 12701917
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaagga |
181 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
12701958 |
aagggaaatgttaactggtgcccccggggcactggttaagga |
12701917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 16536040 - 16536097
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||| | |||||| ||| |||||| |
|
|
| T |
16536040 |
tattttaagggaaatgctaaccggtgcccccggggcacggattaagggtatgaaaaag |
16536097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 191
Target Start/End: Complemental strand, 32202674 - 32202617
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||| |||||||| |||| |||| | ||||| ||| ||||||||||||||||||| |
|
|
| T |
32202674 |
tattttatgggaaatgttaaccggtgtccccggggcacgggttaaggatataaaaaag |
32202617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 55882683 - 55882732
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||| ||||||||||| ||||| |
|
|
| T |
55882683 |
agggaaatgctaaccggtgtctccggggcactcgttaaggatatgaaaaa |
55882732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 8133732 - 8133783
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||||||||||||| ||| | ||| ||||||||||||||||||| ||||||| |
|
|
| T |
8133732 |
aagggaaatgctaaccggt-cttcccggacactggttaaggatatgaaaaaga |
8133783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 12356241 - 12356293
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||| |||||| | | || ||||||||||||||| |||||| |
|
|
| T |
12356241 |
taagggaaatgctaaccggtgcccctgagatactggttaaggatatgaaaaag |
12356293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 179
Target Start/End: Complemental strand, 33108861 - 33108821
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaag |
179 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
33108861 |
taagggaaatgttaaccggtgcctccggggcactggttaag |
33108821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 23)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 34606261 - 34606310
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
34606261 |
gggaaatgctaactggtgcctccggggcactggttaaggatatgaaaaag |
34606310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 145 - 191
Target Start/End: Complemental strand, 11686507 - 11686461
Alignment:
| Q |
145 |
aaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
11686507 |
aaatgctaactggtgcttccgggatactggttaaggatataaaaaag |
11686461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 234 - 318
Target Start/End: Original strand, 18830407 - 18830493
Alignment:
| Q |
234 |
tttgcttctgtgttatacaaaccacgttttccataaaatcac-acaactcac-acgttaacgcaaaagcttcaaatgctagcttata |
318 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||||| || ||| ||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
18830407 |
tttgcttctgcgttttgtaaaccacgttttccataaaattacgacagctcaccacgttaacgcaaaaacttcaaatgctaacttata |
18830493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 47118150 - 47118101
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
47118150 |
gggaaatgctaactggtgcctccggggcactggttaaagatatgaaaaag |
47118101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 18485955 - 18486003
Alignment:
| Q |
136 |
ttttaagggaaatgctaactggtgcctccgggacactggttaaggatat |
184 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
18485955 |
ttttaagggaaatgctaaccggtgcccccggggcactggttaaggatat |
18486003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 230 - 315
Target Start/End: Complemental strand, 8071524 - 8071437
Alignment:
| Q |
230 |
catgtttgcttctgtgttatacaaaccacgttttccataaaatcaca-caactcac-acgttaacgcaaaagcttcaaatgctagctt |
315 |
Q |
| |
|
||||||||||| || || | ||||||||||||||||||||| || |||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8071524 |
catgtttgcttttgcattgtgcaaaccacgttttccataaaaccatggcaactcaccacgttaacccaaaagcttcaaatgctagctt |
8071437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 144 - 190
Target Start/End: Original strand, 22973600 - 22973646
Alignment:
| Q |
144 |
gaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
22973600 |
gaaatgctaactagtgcctccggggcactggttaatgatataaaaaa |
22973646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 191
Target Start/End: Complemental strand, 7689394 - 7689337
Alignment:
| Q |
134 |
tattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||| |||||||||| |||| |||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
7689394 |
tatttaaagggaaatgttaaccggtgtctctgggacactgattaaggatataaaaaag |
7689337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 43594222 - 43594173
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||| | |||| |||||||||||||||||||||||| |
|
|
| T |
43594222 |
gggaaatgctaaccggtgtccccggaacactggttaaggatataaaaaag |
43594173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 184
Target Start/End: Complemental strand, 27456304 - 27456257
Alignment:
| Q |
136 |
ttttaagggaaatgctaactggtgcctccgggacactggttaaggatat |
184 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
27456304 |
tttttagggaaatgctaactggtgcccccggg-cactggttaaggatat |
27456257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 34333281 - 34333333
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
34333281 |
taagggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
34333333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 183
Target Start/End: Complemental strand, 34557083 - 34557036
Alignment:
| Q |
135 |
attttaagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
34557083 |
attttaagggaaatgctaactggtgcc-ccggggcattggttaaggata |
34557036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 29993675 - 29993624
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||| |||||||||||| |||||| |
|
|
| T |
29993675 |
aagggaaatgctaacgggtgcccccggggcaccggttaaggatatgaaaaag |
29993624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 38128489 - 38128430
Alignment:
| Q |
131 |
ttatattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
38128489 |
ttatatttaaagggtcatgctaaccggtgcctccggggcactggttaagcatacaaaaaa |
38128430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 12218627 - 12218573
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||| |||| |||| |||||| |
|
|
| T |
12218627 |
tttaagggaaatgctaaccggtgcccccggggcactggataagtatatgaaaaag |
12218573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 145 - 191
Target Start/End: Original strand, 28262034 - 28262080
Alignment:
| Q |
145 |
aaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||| |||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
28262034 |
aaatgctaaccggtgcctccgggtcaccggttaaggatatgaaaaag |
28262080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 37631729 - 37631679
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||| |||| ||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
37631729 |
agggaaatgttaaccggtgcttccggggcacgggttaaggatataaaaaag |
37631679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 21869406 - 21869439
Alignment:
| Q |
148 |
tgctaactggtgcctccgggacactggttaagga |
181 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
21869406 |
tgctaactggtgcctccgggtcactggttaagga |
21869439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 143 - 192
Target Start/End: Original strand, 47656981 - 47657030
Alignment:
| Q |
143 |
ggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
|||||||||||| ||||| || ||| |||||||||||||||| ||||||| |
|
|
| T |
47656981 |
ggaaatgctaaccggtgcttcgggggcactggttaaggatatgaaaaaga |
47657030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 1736980 - 1737028
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
||||||||||||| ||||| || ||| |||||||||||||||| ||||| |
|
|
| T |
1736980 |
gggaaatgctaaccggtgcttctggggcactggttaaggatatgaaaaa |
1737028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 183
Target Start/End: Original strand, 6097333 - 6097377
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
|||||||||||||||| | |||| ||||| ||||||||||||||| |
|
|
| T |
6097333 |
taagggaaatgctaaccgatgcccccggggcactggttaaggata |
6097377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 183
Target Start/End: Original strand, 20402386 - 20402430
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
|||||||||||||||| |||| | |||||||| |||||||||||| |
|
|
| T |
20402386 |
taagggaaatgctaaccggtgtccccgggacattggttaaggata |
20402430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 143 - 191
Target Start/End: Original strand, 28587911 - 28587958
Alignment:
| Q |
143 |
ggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
28587911 |
ggaaatgctaaccggtgcccccgg-acactggttaaggatatgaaaaag |
28587958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 138 - 190
Target Start/End: Complemental strand, 68480 - 68428
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
68480 |
ttaagggaaatgctaactggtgcccccggggcactggttaaggatatgaaaaa |
68428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 16)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 30486207 - 30486259
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
30486207 |
taagggaaatgctaactggtgcccccggggcactggttaaggatatgaaaaag |
30486259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 31390009 - 31390061
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
31390009 |
taagggaaatgctaactggtgcctccggggcactagttaaggatatgaaaaag |
31390061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 26891850 - 26891800
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
26891850 |
agggaaatgctaaccggtgcccccgggacactgattaaggatataaaaaag |
26891800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 138 - 178
Target Start/End: Original strand, 20252736 - 20252776
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20252736 |
ttaagggaaatgctaactggtgcctccgtgacactggttaa |
20252776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 561706 - 561655
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
561706 |
aagggaaatgctaaccggtgcccccggggcactggttaaggatatgaaaaag |
561655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 1859161 - 1859210
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
1859161 |
agggaaatgctaactggtgcccccggggtaatggttaaggatataaaaaa |
1859210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 135 - 180
Target Start/End: Complemental strand, 35851962 - 35851917
Alignment:
| Q |
135 |
attttaagggaaatgctaactggtgcctccgggacactggttaagg |
180 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |||||||||||| |
|
|
| T |
35851962 |
attttaagggaaatgctaaccggtgcccccggggcactggttaagg |
35851917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 44587902 - 44587951
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
44587902 |
gggaaatgctaaccggtgcccccggggcaccggttaaggatataaaaaag |
44587951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 22068508 - 22068456
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
22068508 |
taagggaaatgctaacaagtgcccccggggcactggttaaggatatgaaaaag |
22068456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 138 - 181
Target Start/End: Original strand, 20363910 - 20363953
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaagga |
181 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
20363910 |
ttaagggaaatgctaactagtgcccccgtgacactggttaagga |
20363953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 192
Target Start/End: Complemental strand, 32361056 - 32361005
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||||| | ||||||| |
|
|
| T |
32361056 |
agggaaatgctaaccggtgcccccggggcactggttaaggatgtgaaaaaga |
32361005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 181
Target Start/End: Complemental strand, 35470413 - 35470367
Alignment:
| Q |
135 |
attttaagggaaatgctaactggtgcctccgggacactggttaagga |
181 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
35470413 |
atttttagggaaatgttaaccggtgcctccggggcactggttaagga |
35470367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 20552931 - 20552980
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| | ||| |||||||||||||||| |||||| |
|
|
| T |
20552931 |
gggaaatgctaaccggtgccccgggggcactggttaaggatatgaaaaag |
20552980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 22887749 - 22887798
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||||||||||||| | |||||||||| || ||||||||||||| ||||| |
|
|
| T |
22887749 |
agggaaatgctaaccgatgcctccggggcagtggttaaggatatgaaaaa |
22887798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 31438646 - 31438695
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
31438646 |
gggaaatgctaaccggtgctcccggggcactggttaaggatatgaaaaag |
31438695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 26387253 - 26387201
Alignment:
| Q |
139 |
taagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
26387253 |
taagggaaatgctaactggtgcctccgaagtacttgttaaggatatgaaaaag |
26387201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 15)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 35132520 - 35132571
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
35132520 |
aagggaaatgctaaccggtgcccccgggacactggttaaggatatgaaaaag |
35132571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 192
Target Start/End: Complemental strand, 2619742 - 2619693
Alignment:
| Q |
143 |
ggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
2619742 |
ggaaatgctaactggtgtctccgggacacttgttaaggatatgaaaaaga |
2619693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 132 - 191
Target Start/End: Complemental strand, 10054548 - 10054489
Alignment:
| Q |
132 |
tatattttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||| ||||||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
10054548 |
tatatattaagggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
10054489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 183
Target Start/End: Complemental strand, 21945049 - 21945006
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
21945049 |
aagggaaatgctaaccggtgcctccggggcactggttaaggata |
21945006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 10069969 - 10070018
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
10069969 |
gggaaatgctaaccggtgcccccggggcactggttaaggatatgaaaaag |
10070018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 35504426 - 35504377
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
35504426 |
gggaaatgctaaccggtgcccccgggacactggttaagggtatgaaaaag |
35504377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 13470149 - 13470200
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
13470149 |
aagggaaatgctaaccggtgcctatggggcactggttaaggatatgaaaaag |
13470200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 13661806 - 13661857
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||||||||||| |||||| |
|
|
| T |
13661806 |
aagggaaatgctaaccggtgcccccggagcactggttaaggatatgaaaaag |
13661857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 192
Target Start/End: Original strand, 6283562 - 6283612
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaaga |
192 |
Q |
| |
|
||||||||||||| |||||||||||| |||| ||||| ||||| ||||||| |
|
|
| T |
6283562 |
gggaaatgctaaccggtgcctccggggcactagttaaagatatgaaaaaga |
6283612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 179
Target Start/End: Original strand, 10955950 - 10955988
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaag |
179 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
10955950 |
agggaaatgctaactgttgcctccggggcactggttaag |
10955988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 11958153 - 11958104
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||| |||||| ||||| ||| |||||| |||||||||||| |
|
|
| T |
11958153 |
gggaaatgctaaccggtgcccccggggcacaggttaaagatataaaaaag |
11958104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 40608722 - 40608681
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggata |
183 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
40608722 |
gggaaatgctaaccggtgctcccgggacactggttaaggata |
40608681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 133 - 181
Target Start/End: Original strand, 8950180 - 8950228
Alignment:
| Q |
133 |
atattttaagggaaatgctaactggtgcctccgggacactggttaagga |
181 |
Q |
| |
|
|||| ||| |||||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
8950180 |
atatattacgggaaatgttaactggtgtctccgggacactagttaagga |
8950228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 138 - 190
Target Start/End: Original strand, 20175223 - 20175275
Alignment:
| Q |
138 |
ttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
|||| |||||||||||| |||| ||||| |||||||||||| |||||||||| |
|
|
| T |
20175223 |
ttaatggaaatgctaaccggtgtctccgagacactggttaaaaatataaaaaa |
20175275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 39069376 - 39069428
Alignment:
| Q |
137 |
tttaagggaaatgctaactggtgcctccgggacactggttaaggatataaaaa |
189 |
Q |
| |
|
|||||||||||||||||| ||||| ||| || |||||||||||| ||| |||| |
|
|
| T |
39069376 |
tttaagggaaatgctaaccggtgcttccagggcactggttaagggtatgaaaa |
39069428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 25719 - 25768
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||||||||||| |||| || |||||||||||| |||||| |
|
|
| T |
25719 |
gggaaatgctaactggtgcctctgggatacgggttaaggatatgaaaaag |
25768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0264 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0264
Description:
Target: scaffold0264; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 22959 - 23010
Alignment:
| Q |
140 |
aagggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||||||||||| |||||| |
|
|
| T |
22959 |
aagggaaatgctaaccggtgcccccggagcactggttaaggatatgaaaaag |
23010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0206 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0206
Description:
Target: scaffold0206; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 11155 - 11107
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
11155 |
agggaaatgctaactggtgcccc--ggacactggttaaggatatgaaaaag |
11107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 53872 - 53822
Alignment:
| Q |
141 |
agggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||| ||| |||||| |
|
|
| T |
53872 |
agggaaatgctaaccggtgcccccggggcactggttaagggtatgaaaaag |
53822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 50548 - 50597
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
50548 |
gggaaatgttaaccggtgcctccggggcactggttaaagatatgaaaaag |
50597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 14896 - 14944
Alignment:
| Q |
142 |
gggaaatgctaactggtgcctccgggacactggttaaggatataaaaaa |
190 |
Q |
| |
|
||||||||||||| |||| | ||||| |||||||||| ||||||||||| |
|
|
| T |
14896 |
gggaaatgctaaccggtgtccccggggcactggttaaagatataaaaaa |
14944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 143 - 191
Target Start/End: Complemental strand, 6295 - 6247
Alignment:
| Q |
143 |
ggaaatgctaactggtgcctccgggacactggttaaggatataaaaaag |
191 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||||||||||||| |||||| |
|
|
| T |
6295 |
ggaaatgctaaccggtgcccctggggcactggttaaggatatgaaaaag |
6247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University