View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6652_low_2 (Length: 255)
Name: NF6652_low_2
Description: NF6652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6652_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 33081558 - 33081793
Alignment:
| Q |
8 |
catcatcatagtaataaatgaaaataagaatatggaagaaactaacttcgccggcactttcgagttcatcatcagagcaaccggcccaaaggggatgagc |
107 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081558 |
catcataacagtaataaatgaaaataagaatatggaagaaactaacttcgccggcactttcgagttcatcatcagagcaaccggcccaaaggggatgagc |
33081657 |
T |
|
| Q |
108 |
tttgaaagcagcttccatattagcaagaaagtcttgtacggcaccactgtctctctcaggatcgggtccatgatttgaaaatgaaactatgaaactgtaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33081658 |
tttgaaagcagcttccatattagcaagaaagtcttgtacggcatcactgtctctctcaggatcgggtccatgatttgaaaacgaaactatgaaactgtaa |
33081757 |
T |
|
| Q |
208 |
aattataattattgcaatgcatcagtgaattgatta |
243 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
33081758 |
aatcataattattgctatgcatcagtgaattgatta |
33081793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University