View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6653_high_19 (Length: 293)
Name: NF6653_high_19
Description: NF6653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6653_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 104 - 292
Target Start/End: Original strand, 43804465 - 43804652
Alignment:
| Q |
104 |
gcttgaacacagcttttaatacaatgtttttgattnnnnnnnntccaatccaatacaatgtttccatatttagttcactgacaagtgattttaggatgtg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
43804465 |
gcttgaacacagcttttaatacaatgtttttgattaaaaaaa-tccaatccaatacaatgtttccatatttagttcactgacaagtgtttttagggtgtg |
43804563 |
T |
 |
| Q |
204 |
tattaacattaatttgtctttaattatttttcagtcaatgtaatttcatgagtgcatactgtttggtagtcagtttcaacagaagtctt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
43804564 |
tattaacattaatttgtctttaattatttttcagtcaatgtaatttcatgagtgtatactttttggtagtcagtttcaatagaagtctt |
43804652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 29 - 67
Target Start/End: Original strand, 43804388 - 43804426
Alignment:
| Q |
29 |
ttttggcatttgttaaggatttcaaaaatataattgtct |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43804388 |
ttttggcatttgttaaggatttcaaaaatataattgtct |
43804426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University