View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6653_low_28 (Length: 241)
Name: NF6653_low_28
Description: NF6653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6653_low_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 43804888 - 43804667
Alignment:
| Q |
19 |
gttacgttggcaacgtaactataaatctataacaccaatgttgagactaatttgctcaactgaagaaaaatggaagttttactcggttttccacgtaatt |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43804888 |
gttacgttagcaacgtaactataaatctataacaccaatgttgagactaatttgctcaactgaagaaaaatggaagtttttctcggttttccacgtaatt |
43804789 |
T |
 |
| Q |
119 |
cttccaccataagtaatcttatttgagacatgttggacattaaatatgattatctctcacaactaaatataaatcttagtttaacacgatgtaggagtct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | | |||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
43804788 |
cttccaccataagtaatcttatttgagatatgtcgaatattaaatatggttatctctcacaactaaatataaatcttagttcaacacgatgta-gagtct |
43804690 |
T |
 |
| Q |
219 |
aaccccttctgctaaactcaatt |
241 |
Q |
| |
|
|| |||| |||||| |||||||| |
|
|
| T |
43804689 |
aatccctcctgctagactcaatt |
43804667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University