View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6653_low_29 (Length: 239)
Name: NF6653_low_29
Description: NF6653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6653_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 25492632 - 25492852
Alignment:
| Q |
1 |
cagcccataacaactttactactatctctaaaagtagcaccatctcctgattggccaggggatcctttcacaacaccatcggcgttaatttttaccaaac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||| |
|
|
| T |
25492632 |
cagcccataataactttactactatctctaaaaatagcaccatctcctgattggccaggggatcctttcacaac--catcactgttaatttttacccaac |
25492729 |
T |
 |
| Q |
101 |
ggtaccattgggaatgctaggcaaccttaataataatgggagctgcacacaaatgacaagtcacccaaagaagtttaaaagagagaactccttaatagaa |
200 |
Q |
| |
|
|| | ||||||| ||||| ||||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
25492730 |
cataggaatgggaatactaggaaacctgaataataaagggagctgcacgcaaatgacaagtcaggcaaagaagtttaaaagagaaaactcctcaatagaa |
25492829 |
T |
 |
| Q |
201 |
ggcatatgatcttggagcatgat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25492830 |
ggcatatgatcttggagcatgat |
25492852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University