View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6654_low_5 (Length: 238)
Name: NF6654_low_5
Description: NF6654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6654_low_5 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10928 - 10706
Alignment:
| Q |
1 |
atgatgggtggcaccagaatccatgattcaaaggacagattgcttacccatttgtggagatgaaatggaatgaatggatgcagattgggaatggacagag |
100 |
Q |
| |
|
||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10928 |
atgatgggtggcacctgtatccatgatctaaaggacagattgcttacccatttgtggagatgaaatggaatgaatggatgcagattgggaaaggacagag |
10829 |
T |
|
| Q |
101 |
ttggcagcagcatgttgtggagcaatactagtagcggaagaagtcatattattttgaaggagatgaataatttgttggtattgttcctggatggtattta |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10828 |
ttggcagcagcttgttgtggagcaatactagtagtggaagaagtcatattattttgaaggagatgaataatttgttggtattgttcctagatggtattta |
10729 |
T |
|
| Q |
201 |
aagaagagctgttttgtgttgtt |
223 |
Q |
| |
|
|||||| | | |||||||||||| |
|
|
| T |
10728 |
aagaagggttattttgtgttgtt |
10706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University