View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6656_low_2 (Length: 270)
Name: NF6656_low_2
Description: NF6656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6656_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 17356015 - 17356249
Alignment:
| Q |
1 |
ttttagggtttgttgtgatgcttgtgttatatgtttttgctagaattttattattgaaattgattttattgagttaaatcaatgttttgggattttggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17356015 |
ttttagggtttgttgtgatgcttgtgttatatgtttttgctagaattttattattgaaattgattttattgagttaaatcaatattttgggattttggag |
17356114 |
T |
|
| Q |
101 |
attttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagcatataatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||| |||||| |
|
|
| T |
17356115 |
attttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagc--ataatt |
17356212 |
T |
|
| Q |
201 |
gttttggatttttcatgaaaaattattctaaattcat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17356213 |
gttttggatttttcatgaaaaattattctaaattcat |
17356249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 34 - 192
Target Start/End: Complemental strand, 36620110 - 36619953
Alignment:
| Q |
34 |
tttttgctagaattttattattgaaattgattttattgagttaaatcaatgttttgggattttggagattttgttgatttgtattattgtgtgcttcatg |
133 |
Q |
| |
|
|||||||| ||| ||| ||||||||||| ||||||||||| | |||| | |||||||||||| || ||||||||| || |||| || |||| |||||| |
|
|
| T |
36620110 |
tttttgcttgaaattttttattgaaattaattttattgagctgaatctaggttttgggattt-ggtttttttgttgaattttattgttttgtgtttcatg |
36620012 |
T |
|
| Q |
134 |
cgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagc |
192 |
Q |
| |
|
||||||| |||| | | |||||||||||||||||| ||||||||| || | ||||||| |
|
|
| T |
36620011 |
tgaacttcaattttgcgttttgttgttttccttcactttattgtttctacagaagcagc |
36619953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University