View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6658_high_5 (Length: 242)
Name: NF6658_high_5
Description: NF6658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6658_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 5743577 - 5743351
Alignment:
| Q |
1 |
cttattgaataaaggtgatcattgttggattctgagagaaacctaaaacac---atttcaccttaagtttcattgtatgtgaaactttttactcacataa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5743577 |
cttattgaataaaggtgatcattgttggattgtgagagaagcctaaaacactacatttcaccttaagtttcattgtatgtgaaacttcttactcacataa |
5743478 |
T |
 |
| Q |
98 |
gacacttcaatatttcccctatcaagtatgagttcacctattcatcaagtttacttcctctcaagtggttttctttcacatacactcgcgtcttagttgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5743477 |
gacacttcaatatttcccctatcaagtatgagttcacctattcatcaagtttacttcctctcaagtggttttctttcacatacactcgcgtcttagttgg |
5743378 |
T |
 |
| Q |
198 |
cttacatacattatgacacatcacctg |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5743377 |
cttacatacattatgacacatcacctg |
5743351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University