View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6658_high_6 (Length: 226)
Name: NF6658_high_6
Description: NF6658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6658_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 47923942 - 47923748
Alignment:
| Q |
17 |
actataaaactattaagaatgaaaataatacttgcttgtttatgaaccagggcaatgaaaaaatccaactgctttcataagtatggtcatgaagcggatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47923942 |
actataaaactattaagaatgaaaataatacttgcttatttctgaaccagggcaataaaaaaatccaactgctttcataagtatggtcatgaagcggatt |
47923843 |
T |
|
| Q |
117 |
gcaaaatatccaattatcaatttatggtcatctttggggttacagagattttactaagccaaatcccagatttccatgaactctcctggctctct |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47923842 |
gcaaaatatccaattatcaatttatggccatctttggggttacagagattttactaagccaaatcccagatttccatgaactctcctggctctct |
47923748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 47 - 211
Target Start/End: Complemental strand, 47902774 - 47902610
Alignment:
| Q |
47 |
cttgcttgtttatgaaccagggcaatgaaaaaatccaactgctttcataagtatggtcatgaagcggattgcaaaatatccaattatcaatttatggtca |
146 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||| || |||||||||||| | || ||| ||||| ||||| |||||||| ||| ||||||||| || |
|
|
| T |
47902774 |
cttgcttgtttctgaaccagggccataaaaaaatcgaattgctttcataaggaaggccatttggcggactgcaagatatccaactataaatttatggcca |
47902675 |
T |
|
| Q |
147 |
tctttggggttacagagattttactaagccaaatcccagatttccatgaactctcctggctctct |
211 |
Q |
| |
|
|||| || || |||||||||||||||| ||| ||||||||||||||||| || ||||||||| |
|
|
| T |
47902674 |
tcttcggaattgttgagattttactaagcctaattccagatttccatgaactttcatggctctct |
47902610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 75 - 211
Target Start/End: Complemental strand, 47917626 - 47917490
Alignment:
| Q |
75 |
aaaaatccaactgctttcataagtatggtcatgaagcggattgcaaaatatccaattatcaatttatggtcatctttggggttacagagattttactaag |
174 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| || |||| | | | || ||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
47917626 |
aaaaatgcaattgctttcataagtatggtcatgaagctgactgcagtacaacaaactatcaatttatggccatctttggaatctttgagattttactaag |
47917527 |
T |
|
| Q |
175 |
ccaaatcccagatttccatgaactctcctggctctct |
211 |
Q |
| |
|
||||| || | ||||||||||| || ||||||||| |
|
|
| T |
47917526 |
tcaaattcccaacttccatgaactttcatggctctct |
47917490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 40 - 211
Target Start/End: Complemental strand, 47909460 - 47909289
Alignment:
| Q |
40 |
aataatacttgcttgtttatgaaccagggcaatgaaaaaatccaactgctttcataagtatggtcatgaagcggattgcaaaatatccaattatcaattt |
139 |
Q |
| |
|
|||||||| ||| ||||| || ||||||||||| | |||||||| |||||||||||| | || ||| ||||| ||||| |||||||| | | |||| |
|
|
| T |
47909460 |
aataatacctgcatgtttttgtaccagggcaataagtaaatccaattgctttcataagaaagggcatttggcggactgcaatatatccaactttacattt |
47909361 |
T |
|
| Q |
140 |
atggtcatctttgg--ggttacagagattttactaagccaaatcccagatttccatgaactctcctggctctct |
211 |
Q |
| |
|
|||| ||| ||||| | || |||| ||||||| |||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
47909360 |
atggccatttttggaagctttcaga--ttttactgagccaaattccagatttccatgaactttcatggctctct |
47909289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 47898170 - 47898121
Alignment:
| Q |
162 |
agattttactaagccaaatcccagatttccatgaactctcctggctctct |
211 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| || ||||||||| |
|
|
| T |
47898170 |
agattttactaagccaaattccatatttccatgaactttcatggctctct |
47898121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 125
Target Start/End: Original strand, 47924628 - 47924660
Alignment:
| Q |
93 |
ataagtatggtcatgaagcggattgcaaaatat |
125 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
47924628 |
ataagtatggtcatgaaacggattgcaaaatat |
47924660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University