View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6659_low_13 (Length: 241)
Name: NF6659_low_13
Description: NF6659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6659_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 50531835 - 50531610
Alignment:
| Q |
17 |
actcttccgtattttttgtcgttttcttatacctttaactttatgatcatatgcatttctgtactatatacaatcttttttgcatccattcgggatttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50531835 |
actcttccgtattttttgtcgttttcttatacctttaactttatgatcatatgcatttctgtactatatacaatcttttttgcatccattcgggatttca |
50531736 |
T |
 |
| Q |
117 |
cgcgtagtaag-nnnnnnnnnnnnaagaaataaattgttttatctcctttttgctcttaagagcaaagagtaactttatgtgaactttactggatctgga |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50531735 |
cgcgtagtaagtttttctttttttaagaaataaattgttttatctcctttttgctcttaagagcaaagagtaactttacgtgaactttactggatctgga |
50531636 |
T |
 |
| Q |
216 |
aacctattttaaaataagcttaaaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
50531635 |
aacctattttaaaataagcttaaaat |
50531610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University