View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6659_low_14 (Length: 238)
Name: NF6659_low_14
Description: NF6659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6659_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26398095 - 26398316
Alignment:
| Q |
1 |
ttgcattgataatgatatgtggtggatttgtcaacatgttgattgaatatgcagtgttctgttcctaatatttctcatattcggttggggttggtgatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26398095 |
ttgcattgataatgatatgtggtggatttgtcaacatgttgattgaatatgcagtgttctgttcctaatctttctcatattcggttggggttggtgatac |
26398194 |
T |
 |
| Q |
101 |
tgtaattcgattattaatcttatctcaacctgtcttggtattttatatcttgagtataggttttattagaaatatcctatctagtgttttaaaaatcaga |
200 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
26398195 |
tgtaattctattattaatcttatctcatcctgtctttgtattttatatcttgagtataggttttattagaaatgtcctatccagtgttttaaaaatcaga |
26398294 |
T |
 |
| Q |
201 |
ccaaccatcaaccggcaaggtc |
222 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
26398295 |
ccaaccatcaaccagcaaggtc |
26398316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University