View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6659_low_7 (Length: 338)
Name: NF6659_low_7
Description: NF6659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6659_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 2 - 167
Target Start/End: Complemental strand, 1256734 - 1256569
Alignment:
| Q |
2 |
ttctatacaagggcattagtttctannnnnnngttactgcattttatgattatgtttcggcttttcctaattaacaaaagttgtagaaactgaaataggg |
101 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
1256734 |
ttctatacaaggacattagtttctatttttttgttactgcattttatgattatgtttcggcttttcctaattgacaaaagttgtagaaactgaaacaggg |
1256635 |
T |
 |
| Q |
102 |
gcttgtagtttttatttagatataggcttgtaatggtggaattagggagggaaaaatgtaaattga |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1256634 |
gcttgtagtttttatttagatataggcttgtaatggtggaattagggagggaaaagtgtaaattga |
1256569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 240 - 324
Target Start/End: Complemental strand, 1256495 - 1256411
Alignment:
| Q |
240 |
atgtataactcttgatgacttcttccttattgtccattgatctaacattatctatgattaatgtattttattctactttcttatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256495 |
atgtataactcttgatgacttcttccttattgtccattgatctaacattatctatgattaatgtattttattctactttcttatg |
1256411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University