View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6660_low_8 (Length: 348)
Name: NF6660_low_8
Description: NF6660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6660_low_8 |
 |  |
|
| [»] scaffold0856 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 4048 - 3824
Alignment:
| Q |
19 |
aaaatcgtttgcaggttattgtatatttttggtacagagtttgataacttgtccctctagaaaataaaaagttgtgtcaagatctaggcagaatcagaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048 |
aaaatcgtttgcaggttattgtatatttttggtacagagtttgataacttgtccctctagaaaataaaaagttgtgtcaagatctaggcagaatcagaat |
3949 |
T |
 |
| Q |
119 |
acaaggcattagcagaccttgcagcacatgtatcttgaatccggtctatattataggaaataaagttgaaatacctcaaacaagtgtattgtggtgtgaa |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3948 |
acaagacattagcagaccttgcagcacatgtagcttgaatccgatctatattataggaaataaagttgaaatacctcaaacaagtgtattgtggtgtgaa |
3849 |
T |
 |
| Q |
219 |
aatttgagtgctaagcttttgcttc |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3848 |
aatttgagtgctaagcttttgcttc |
3824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 277 - 338
Target Start/End: Complemental strand, 3817 - 3756
Alignment:
| Q |
277 |
agaagtggatgtgcactatatcagagatcagttgttgagtaataacgtgactatagcctatg |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3817 |
agaagtggatgtgcactatatcagagatcagttgttgagtaataacgcgactatagcctatg |
3756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University