View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6662_high_5 (Length: 280)

Name: NF6662_high_5
Description: NF6662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6662_high_5
NF6662_high_5
[»] chr7 (1 HSPs)
chr7 (18-280)||(34315185-34315447)
[»] chr5 (1 HSPs)
chr5 (127-279)||(40947382-40947534)
[»] chr8 (1 HSPs)
chr8 (127-279)||(26956112-26956264)


Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 34315447 - 34315185
Alignment:
18 gttatcgcgttgactcgcgctttgaagattctcggatcggaaggatcgctccaatgaacagaaccaacgtggcgactaccggagaaattgtagaagtgta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34315447 gttatcgcgttgactcgcgctttgaagattctcggatcggaaggatcgctccaatgaacagaaccaacgtggcgactaccggagaaattgtagaagtgta 34315348  T
118 atccagcatcagattcagttccaacggcggcaatctccggccagactctgcaaattgaattgatctcatcgaggtgagtacgaacggttgcggaatggat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34315347 atccagcatcagattcagttccaacggcggcaatctccggccagactctgcaaattgaattgatctcatcgaggtgagtacgaacggttgcggaatggat 34315248  T
218 tagattccagtcgtagctggagagttgaccaccgtgagcaatccaaacggaaccgttctccgc 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34315247 tagattccagtcgtagctggagagttgaccaccgtgagcaatccaaacggaaccgttctccgc 34315185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 127 - 279
Target Start/End: Complemental strand, 40947534 - 40947382
Alignment:
127 cagattcagttccaacggcggcaatctccggccagactctgcaaattgaattgatctcatcgaggtgagtacgaacggttgcggaatggattagattcca 226  Q
    |||||||||||||| |||||||| |||| |||||||||||||||||||||||||| |||||||| || | ||| |||||| |||||||||||||||||||    
40947534 cagattcagttccagcggcggcactctctggccagactctgcaaattgaattgatttcatcgagatgtgaacggacggttacggaatggattagattcca 40947435  T
227 gtcgtagctggagagttgaccaccgtgagcaatccaaacggaaccgttctccg 279  Q
    |||||||||||||||||||||||||  ||||||||||  |||||| |||||||    
40947434 gtcgtagctggagagttgaccaccgatagcaatccaagtggaaccattctccg 40947382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 127 - 279
Target Start/End: Complemental strand, 26956264 - 26956112
Alignment:
127 cagattcagttccaacggcggcaatctccggccagactctgcaaattgaattgatctcatcgaggtgagtacgaacggttgcggaatggattagattcca 226  Q
    |||||||||||||| |||||||| |||| |||||||||||||||||||||||||| |||||||| || | ||| |||||| |||||||||||||||||||    
26956264 cagattcagttccagcggcggcactctctggccagactctgcaaattgaattgatttcatcgagatgtgaacggacggttacggaatggattagattcca 26956165  T
227 gtcgtagctggagagttgaccaccgtgagcaatccaaacggaaccgttctccg 279  Q
    ||||||||||| ||||||||| |||  ||||||||||  |||||| |||||||    
26956164 gtcgtagctggtgagttgacctccgatagcaatccaagtggaaccattctccg 26956112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University