View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6662_high_8 (Length: 234)
Name: NF6662_high_8
Description: NF6662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6662_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 3916330 - 3916115
Alignment:
| Q |
1 |
ttgttacggcgattctgaacggacacaccgaagctgccggtagaggagctgaaccaccaaaggatggaagtgtttacgaacccgaagggtatggaggttt |
100 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916330 |
ttgttacggcgattctgaacggccacatcgaagctgccggtagaggagctgaaccaccaaaggatggaagtgtttacgaacccgaagggtatggaggttt |
3916231 |
T |
|
| Q |
101 |
tccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttggcctttgttttgccctgattatcaaaagatgtgtctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3916230 |
tccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttggcctttgttttgtcctgattatcaaaagatgtgtctt |
3916131 |
T |
|
| Q |
201 |
tattacaaagccacag |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3916130 |
tattacaaagccacag |
3916115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University