View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6663_high_10 (Length: 209)

Name: NF6663_high_10
Description: NF6663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6663_high_10
NF6663_high_10
[»] chr2 (2 HSPs)
chr2 (25-134)||(38836461-38836566)
chr2 (117-159)||(38836564-38836606)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 38836461 - 38836566
Alignment:
25 tatatcagtatgttactcttgcttgcatatcaactttggaattgagacatccttgtttgtgtatcaaatgcgtgttagaagactcaaattatataaaata 124  Q
    |||||||||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
38836461 tatatcagtatgttactcttg----catatcaactttggaattgagatatccttgtttgtgtatcaaatgcgtgttagaagactcaaattatataaaata 38836556  T
125 aaataaaata 134  Q
    ||||||||||    
38836557 aaataaaata 38836566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 38836564 - 38836606
Alignment:
117 ataaaataaaataaaatagaggttgaacatggacgaacctata 159  Q
    ||||||||||||||||||||||||||| |||||||||||||||    
38836564 ataaaataaaataaaatagaggttgaatatggacgaacctata 38836606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University