View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6663_low_12 (Length: 209)
Name: NF6663_low_12
Description: NF6663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6663_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 38836461 - 38836566
Alignment:
| Q |
25 |
tatatcagtatgttactcttgcttgcatatcaactttggaattgagacatccttgtttgtgtatcaaatgcgtgttagaagactcaaattatataaaata |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38836461 |
tatatcagtatgttactcttg----catatcaactttggaattgagatatccttgtttgtgtatcaaatgcgtgttagaagactcaaattatataaaata |
38836556 |
T |
|
| Q |
125 |
aaataaaata |
134 |
Q |
| |
|
|||||||||| |
|
|
| T |
38836557 |
aaataaaata |
38836566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 159
Target Start/End: Original strand, 38836564 - 38836606
Alignment:
| Q |
117 |
ataaaataaaataaaatagaggttgaacatggacgaacctata |
159 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38836564 |
ataaaataaaataaaatagaggttgaatatggacgaacctata |
38836606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University