View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6663_low_5 (Length: 381)
Name: NF6663_low_5
Description: NF6663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6663_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 24799638 - 24800001
Alignment:
| Q |
1 |
atttatattgagttatgttctttgcatcgaccttcaaatgttgcttttgttcatgggaaattgggaataagggcaaaatgcaaatgagtaatgaacctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24799638 |
atttatattgagttatgttctttgcatcgaccttcaaatgttgcttttgttcatgggaaattgggaataagggcaaaatgcaaatgagtagtgaacctag |
24799737 |
T |
 |
| Q |
101 |
acgcaatattgaatcaaagggaatgatgtatttgaagtataggagatagatcgaatattgtaaggacaagcaatatcgattggccacatgacattctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24799738 |
acgcaatattgaatcaaagggaatgatgtatttgaagtataggagatagatcgaatattgtaaggacaagcaatatcgattggccacatgacattctgaa |
24799837 |
T |
 |
| Q |
201 |
catgttttctgcttcagaagtacttaactatcattttcaannnnnnnnnnnnnnnatgtgtagacaagtttttgaaggaatctagtttagttcgtgtgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24799838 |
catgttttctgcttcagaagtacttaactatcattttc-atttatttatttatttatgtgtagacaagtttttgaaggaatctagtttagttcgtgtgaa |
24799936 |
T |
 |
| Q |
301 |
actgtcagaaaatgtgtcttcaatgtggtgttagagatgtattcatcaattcaattggctcctta |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24799937 |
actgtcagaaaatgtgtcttcaatgtggtgttagagatgcattcatcaattcaattggctcctta |
24800001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University