View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6663_low_9 (Length: 265)
Name: NF6663_low_9
Description: NF6663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6663_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 257
Target Start/End: Original strand, 48451522 - 48451759
Alignment:
| Q |
20 |
gaaaattctcaaatatcaacttatctatcattctgaatccctacctcatagttatatttatttccttactatgtgattaaatttcttttattgcattcac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451522 |
gaaaattctcaaatatcaacttatctatcattctgaatccctacctcatagttatatttatttccttactatgtgattaaatttcttttattgcattcac |
48451621 |
T |
|
| Q |
120 |
tgttacccacttgtgtgttctctaaattaacatttgtgtgacattatgaaaactttgcagtcaaaattactgataaccctgcggacaagttagtagctgc |
219 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451622 |
tgttacccacttgtgtgttctctacattaacatttgtgtgacattatgaaaactttgcagtcaaaattactgataaccctgcggacaagttagtagctgc |
48451721 |
T |
|
| Q |
220 |
tatcaacgaaaatagaactgctcacaaggattcatctc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451722 |
tatcaacgaaaatagaactgctcacaaggattcatctc |
48451759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University