View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6664_high_14 (Length: 250)
Name: NF6664_high_14
Description: NF6664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6664_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 17546149 - 17545932
Alignment:
| Q |
18 |
actattggacgagctaggtgcacattttttagcaacagattattcaacttctctggaacacaagaaccagacaattctttagaatatgaaatgctaactg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17546149 |
actattggacgagctaggtgcacattttttagcaacagattattcaacttctctggaacacaagaaccagacaattctttagaatatgaaatgctaactg |
17546050 |
T |
|
| Q |
118 |
aattgcaaaacttgtgtccacaagatggagatggtaacacaactactgttctagatccttactcatttgatcaatttgataacaattacttcaagaattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17546049 |
aattgcaaaacttgtgtccacaagatggagatggtaacacaactactgttcttgacccctactcatttgatcaatttgataacaattacttcaagaattt |
17545950 |
T |
|
| Q |
218 |
actaaatggaaagggtct |
235 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
17545949 |
acttaatggaaagggtct |
17545932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University