View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6664_low_10 (Length: 281)
Name: NF6664_low_10
Description: NF6664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6664_low_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 281
Target Start/End: Original strand, 13282388 - 13282653
Alignment:
| Q |
16 |
acttactttcttaaattttgtaatttaattaaccgacaccttgtagttgctaaaatatttacattgaaaattactactcctattgctagtacctagaaga |
115 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13282388 |
acttactttcttaatttttgtaatttagttaaccgacaccttgtagttgctaaaatatttacattgaaaattactactcctattgctagtacctagaaga |
13282487 |
T |
 |
| Q |
116 |
taaacattttaagaggctcacaaaagaagtatagttacataaacttctaacaatagttaccctttaacagtatggtacaatgtacaaatggtaacaagca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13282488 |
taaacattttaagaggctcacaaaagaagtatagttacataaacttctaacaatagttacacttttacagtatggtacaatgtacaaatggtaacaagca |
13282587 |
T |
 |
| Q |
216 |
cttagatcctcacccaccacattgccaaacaaaataattgacaagatagagaataatctacccacc |
281 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| || |||||||| |
|
|
| T |
13282588 |
cttagatcctcacccactacattgccaaacaagataattgacaagatagagaagcatatacccacc |
13282653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University