View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6664_low_14 (Length: 250)

Name: NF6664_low_14
Description: NF6664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6664_low_14
NF6664_low_14
[»] chr2 (1 HSPs)
chr2 (18-235)||(17545932-17546149)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 17546149 - 17545932
Alignment:
18 actattggacgagctaggtgcacattttttagcaacagattattcaacttctctggaacacaagaaccagacaattctttagaatatgaaatgctaactg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17546149 actattggacgagctaggtgcacattttttagcaacagattattcaacttctctggaacacaagaaccagacaattctttagaatatgaaatgctaactg 17546050  T
118 aattgcaaaacttgtgtccacaagatggagatggtaacacaactactgttctagatccttactcatttgatcaatttgataacaattacttcaagaattt 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||    
17546049 aattgcaaaacttgtgtccacaagatggagatggtaacacaactactgttcttgacccctactcatttgatcaatttgataacaattacttcaagaattt 17545950  T
218 actaaatggaaagggtct 235  Q
    ||| ||||||||||||||    
17545949 acttaatggaaagggtct 17545932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University