View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6664_low_5 (Length: 384)
Name: NF6664_low_5
Description: NF6664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6664_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 163
Target Start/End: Original strand, 8164603 - 8164749
Alignment:
| Q |
18 |
ggcagcaccaagatcaccacttgaaacattactgaaacataaatgcctttgtccttttgcatg-tagtacaacattttgaactaactcacttgtcttcac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8164603 |
ggcagcaccaagatcaccacttgaaacattactgaaacataaatgcctttgtccttttgcatggtagtacaacattttgaactaactcacttgtcttcac |
8164702 |
T |
 |
| Q |
117 |
tcaaacaatcattaaaaaacatcattttttgcagaactagttatggg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8164703 |
tcaaacaatcattaaaaaacatcattttttgcagaactagttatggg |
8164749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 278 - 384
Target Start/End: Original strand, 8164864 - 8164982
Alignment:
| Q |
278 |
aaaaatatccactcaaataaacaatctttattaatatatctc------------tctctcaagtacattatttcaacttttttaacaaaatactcttctt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||| |||||||||||| | |||||| |||||||| |
|
|
| T |
8164864 |
aaaaatatccactcaaataaacaatctttattaatctctctctctctctctctctctctcaagtacattgtttcaactttttgagcaaaattctcttctt |
8164963 |
T |
 |
| Q |
366 |
attagattccttgtgaaat |
384 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
8164964 |
ggtagtttccttgtgaaat |
8164982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University