View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_high_19 (Length: 311)
Name: NF6665_high_19
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 18722940 - 18723221
Alignment:
| Q |
20 |
ctttctcaaaggcagactactcagcttacttgtgaagaaaggaaggaagtagagaaaacgttgaagaacatcagagtctttgtttgccatagagaaactg |
119 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18722940 |
ctttctcagaggcagacaactcagctaacttgtgaagaaaggaaggaagtagagaaaacgttgaagaatatcagagtctttgtttgccatagagaaactg |
18723039 |
T |
|
| Q |
120 |
ttcagagataccgtgtctatggcttaactgaggaggcaactgaaaatctttggtttcctgatagagatggaaagaatctgaggcttatgagttactttaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18723040 |
ttcagagataccgtgtctatggcttaactgaggaggcaactgaaaatctttggtttcctgatagagatggaaagaatctgaggcttatgagttactttaa |
18723139 |
T |
|
| Q |
220 |
agatcactataactacgacattcaattcaggaagtggccatgcttgcaaattagtagaagtaaaccttgttatctccctatg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18723140 |
agatcactataactacgacattcaattcaggaagtggccatgcttgcaaattagtagaagtaaaccttgttatctccctatg |
18723221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University