View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_high_23 (Length: 285)
Name: NF6665_high_23
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_high_23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 285
Target Start/End: Original strand, 30383489 - 30383762
Alignment:
| Q |
11 |
ttatacttcaaagtagttgcttggagtgacttaacattgttatccttaggcttttcaaagatcttttgagtgctgctattgcatgcatacttttgtcttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30383489 |
ttatacttcaaagtagttgcttggagtgacttaacattgttatccttaggcttttcaaagatcttttgagtgctgctattgcatgcatacttttgtcttt |
30383588 |
T |
 |
| Q |
111 |
gggttccaaatttaattgttttaaacatatcatacagattcaatggtgcaaataca-nnnnnnnnncttctttcagcggctgagttatgagattaattgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30383589 |
gggttccaaatttaattgttttaaacatatcatacagattcaatggtgcaaatacatttttttttccttctttcagcggctgagttatgagattaattgt |
30383688 |
T |
 |
| Q |
210 |
aggcttctgaagccacgtatattgaacctctgtgtgtataagaaattttattcttttgttccaaggattggataca |
285 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30383689 |
aggcttctgaagccacatatattgaacctc--tgtgtataagaaattttattcttttgttccaaggattggataca |
30383762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University