View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_high_24 (Length: 284)
Name: NF6665_high_24
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 269
Target Start/End: Original strand, 33974717 - 33974974
Alignment:
| Q |
10 |
aagaaaattatctcaatacagcttttctttatatttgtagggcatacaatgcaccaaatgccaatgtgttcattggaaaaggatggcctgtatattttct |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33974717 |
aagaaaattatctcaatacaacttttctttatacttgtagggcatacaatgcaccaaatgccaatgtgttcattggaaaaggatggcctttatattttct |
33974816 |
T |
 |
| Q |
110 |
taggttttaaatcttcaccgaagattcttcacccctactttaactaacggctcaacattttatcaaattaaaaaccctcctctttttatctttcaattgt |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
33974817 |
taggttttaaatcttcactgaagattcttcgccccta-tttaactaacggctcaacattttatcaaattaaaaacactcctctttttatctttcaatggt |
33974915 |
T |
 |
| Q |
210 |
caaaatatctttannnnnnnnagtgagaaaacttcagagattcttgattagtgaacaata |
269 |
Q |
| |
|
|||||||| |||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33974916 |
caaaatattttta-tttttttagtaagaaaacttcagagattcttgattagtgaacaata |
33974974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University