View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_high_27 (Length: 279)
Name: NF6665_high_27
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_high_27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 45 - 279
Target Start/End: Original strand, 10343936 - 10344169
Alignment:
| Q |
45 |
ttcatttctttggattcagttttatactttcggagcatttgcatattttacctttctttggttaatttcctgtatccaacaattatttagttataacaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343936 |
ttcatttctttggattcagttttatactttcggagcatttgcatattttacccttctttggttaatttcctgtatccaacaattatttagttataacaaa |
10344035 |
T |
 |
| Q |
145 |
aatatgttcatagcatgtgcgaagcttttactactttgatgagtcggttattgaaaacataatcttttaggatcacctctaggccaaaattgtttatatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10344036 |
aatatgttcatagcatgtgcgaagcttttactactttgatgagtcggttattgaaaacataatcttttaggatcacctctaggccaaaattgtttatatc |
10344135 |
T |
 |
| Q |
245 |
ctaattagtgtgaaactggcaattaatcttacttt |
279 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
10344136 |
ctaattagtgtgaaac-ggcaattaatcttacttt |
10344169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University