View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_high_39 (Length: 238)
Name: NF6665_high_39
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 55030417 - 55030193
Alignment:
| Q |
1 |
gtttaattcacattctactgcacatccaaaataaacaaaaatggtctaaaaaccttatgattaatcaagnnnnnnn-aataaattactgaaacaaaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55030417 |
gtttaattcacattctactgcacatccaaaataaacaaaaatggtctaaaaaccttatgattaatcaagttttttttaataaattactgaaacaaaaatg |
55030318 |
T |
 |
| Q |
100 |
agtaagatggcaacatcgtattttagacacacatttagttacattgataaaattataatttttggagacatcttattgctgataggaaaatgcgtggatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55030317 |
agtaagatggcaacatcgtattttagacacacatttagttacattgataaaattataatttttggagacatcttattgctgataggaaaatgcgtggatg |
55030218 |
T |
 |
| Q |
200 |
tttcatcatttaggggttggttatg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
55030217 |
tttcatcatttaggggttggttatg |
55030193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University