View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_low_15 (Length: 352)
Name: NF6665_low_15
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 2916995 - 2917196
Alignment:
| Q |
18 |
gtatgaaggccatttgaccagttatggatgaactcagattctggagagtttttcacattcatacatctaggacatcgatgataattcaattaagattaga |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2916995 |
gtatggaggccatttgaccagttatggatgaactcagattctggagagtttttcacattcatacatctaggacatcgatgataattcaattaagattaga |
2917094 |
T |
|
| Q |
118 |
tggtcaaattataaggtggctttttaaattatatcaggttaaacctgatcatttggaatcagttctggagttgtgaattgcatgcaattgcactttttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2917095 |
tggtcaaattataaggtggctttttaaattatatcaggttaaacctgatcatttggaatcagttctggagttgtgaattgcatgcaattgcactttttat |
2917194 |
T |
|
| Q |
218 |
tg |
219 |
Q |
| |
|
|| |
|
|
| T |
2917195 |
tg |
2917196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University