View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_low_18 (Length: 316)
Name: NF6665_low_18
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 190 - 297
Target Start/End: Complemental strand, 52732975 - 52732868
Alignment:
| Q |
190 |
tttccactaaaacaactttgactccattaaaattaaaaccaaacagacacaccatgagagtgtgatatgtagtttccagaatgtgaagaaagaggaatac |
289 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52732975 |
tttccactaaaacaactttgactcccttaaaattaaaaccaaacagacacaccatgagagtgtgatatgtagtttccagaatgtgaagaaagaggaatac |
52732876 |
T |
 |
| Q |
290 |
aataggag |
297 |
Q |
| |
|
|||||||| |
|
|
| T |
52732875 |
aataggag |
52732868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 52733152 - 52733057
Alignment:
| Q |
1 |
taaaaagttgattgga-actaaatttaaaggttaaaatcaacgggagagtacaaaagctatcaaattttagtttgaaactataatcaattctttgt |
95 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52733152 |
taaaaagttgattggacactagatttaaaggttaaaatcaacgggagagtacaaaagctatcaaattttagtttgaaactataatcgattctttgt |
52733057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University