View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_low_27 (Length: 281)
Name: NF6665_low_27
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 42453199 - 42453467
Alignment:
| Q |
1 |
ttgtacaaaaagtacacagtgccaatgctttttccacaacatttcgaggatccgctgtctcaagctcagttatacggattaaggcaacaaactatcgagc |
100 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453199 |
ttgtataaaaagtacacaatgccaatgctttttccacaacatttcgaggatccgctgtctcaagctcagttatacggattaaggcaacaaactatcgagc |
42453298 |
T |
 |
| Q |
101 |
ttgtgcggtcaaatatgagcaaagctgaaccgccgttgagaaatgaggttgttgattatatgctagattcacgtgaaatcgtgtggagtatgagaagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453299 |
ttgtgcggtcaaatatgagcaaagctgaaccgccgttgagaaatgaggttgttgattatatgctagattcacgtgaaatcgtgtggagtatgagaagatg |
42453398 |
T |
 |
| Q |
201 |
taaagctgattttgagaggatcaacgtctttctaaattgcttggttggtatttacacttattttgatga |
269 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453399 |
taaagctgattttgagaggattaacgtctttctaaattgcttggttggtatttacacttattttgatga |
42453467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University