View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_low_28 (Length: 280)
Name: NF6665_low_28
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 30831675 - 30831421
Alignment:
| Q |
18 |
atatttaccattagagatcatttccttaacaattgagtcaaaaaatttgtagatattagaaagaatatttagcatatcaacaggaggagatccgaaccaa |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831675 |
atatttagcattagagatcatttccttaacagttgagtcaaaaaaattgtagatattagaaagaatatttagcatatcaacaggaggagatccgaaccaa |
30831576 |
T |
 |
| Q |
118 |
tattataagcattccttatgatgcaaaatgaatgatttctcatccacgtagttcttctgaccatgccaaaatgatgatggaatatggtgagaaattgggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831575 |
tattataagcattccttatgatgcaaaatgaatgatttctcatccacgtagttcttctgaccatgccaaaatgatgatggaatatggtgagaaattgggt |
30831476 |
T |
 |
| Q |
218 |
ctttactctttacctctaaggaatctaagtatgcataacttagcacattcatctc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831475 |
ctttactctttacctctaaggaatctaagtatgcataacttagcacattcatctc |
30831421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University