View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_low_39 (Length: 240)
Name: NF6665_low_39
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_low_39 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 30384181 - 30383959
Alignment:
| Q |
18 |
atcggaccctgaagtttcactcatgcattgcaagttgcacgaatcaaaaacactgatagccaatagttgctaattgctggtgtacttcggtggaacatgt |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
30384181 |
atcggaccctgaagcttcactcatgcattgcaagttgcacgaatcaaaaacactgatagctaataattgctaattgcttgtgtacttcggtggaacatgt |
30384082 |
T |
 |
| Q |
118 |
gtctcctcaggtggatttgattctccaggaagatgcttgtagttgctatctccagctcagggtagcttagtctactctgttctttcagttctaaaataat |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30384081 |
gcctcctcaggtggatttgattctccaggaagatgcttgtagttgcaatctacagctcagggtagcttagtctactctgttctttcagttctaaaataat |
30383982 |
T |
 |
| Q |
218 |
gtgaatcttctttggtacaagtc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30383981 |
gtgaatcttctttggtacaagtc |
30383959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University