View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6665_low_43 (Length: 238)
Name: NF6665_low_43
Description: NF6665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6665_low_43 |
 | |
|
| [»] scaffold0122 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 13855633 - 13855411
Alignment:
| Q |
1 |
tttctcaaattattagtagtgtcgatgtgtcagtttccatgtcgtgtttggtaacgggtgtctatatccgttcttcataggtatacttaaaattatcctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13855633 |
tttctcaaattattagtagtgtcgatgtgtcagtttccatgtcgtgtttagtaacgggtgtctatatccgttcttcataggtatacttaaaattatcctc |
13855534 |
T |
|
| Q |
101 |
gataactacgtgtcagtgtccttatcgtgtcatgtcagtaattcatacatcaacattatcaaaacaaaacacagacacataccgatttaacctttccaaa |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13855533 |
gataactacgtgtcagtgtccctatcgtgtcatgtcagtaattcatacatcaacattatcaaaacaaaacacagacacataccgatttaacctttccaaa |
13855434 |
T |
|
| Q |
201 |
cttctccccatcctccaaaaact |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13855433 |
cttctccccatcctccaaaaact |
13855411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 139 - 222
Target Start/End: Complemental strand, 13849706 - 13849622
Alignment:
| Q |
139 |
taattcatacatcaacattatcaaaac-aaaacacagacacataccgatttaacctttccaaacttctccccatcctccaaaaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
13849706 |
taattcatacatcaacattatcaaaaccaaaacacaaacacataccgatttaaccttgccaaacttctctccatcctccaaaaac |
13849622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 34298458 - 34298407
Alignment:
| Q |
1 |
tttctcaaattattagtagtgtcgatgtgtcagtttccatgtcgtgtttggt |
52 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |||||||| |||| |
|
|
| T |
34298458 |
tttctcaaattattagtggtgtcggtgtgtcagtttccgtgtcgtgtctggt |
34298407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 8682 - 8642
Alignment:
| Q |
7 |
aaattattagtagtgtcgatgtgtcagtttccatgtcgtgt |
47 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
8682 |
aaattattagaagtgtcgacgtgtcagtgtccatgtcgtgt |
8642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University