View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6667_high_3 (Length: 308)

Name: NF6667_high_3
Description: NF6667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6667_high_3
NF6667_high_3
[»] chr7 (1 HSPs)
chr7 (50-268)||(4972349-4972563)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 50 - 268
Target Start/End: Complemental strand, 4972563 - 4972349
Alignment:
50 atagataattttgttgggtttgggagatttaggatnnnnnnnntgataaagctgataaatttattaatttcataggaaacatgatgggaattgttgaaaa 149  Q
    |||||||||||||||||||||||||||||||||||        | |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4972563 atagataattttgttgggtttgggagatttaggataaaaaaaattataaagctgataaatttattaatttcataggaaacatgatgggaattgttgaaaa 4972464  T
150 acatggtgattgattgtttgatatattggatattggaggtgattgcacttgcatttactgctttaaattattgattgtatttccctgttaagtagttatt 249  Q
    ||||||||||||    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
4972463 acatggtgattg----tttgatatattggatattggaggtgattgcacttgcagttactgctttaaattattgattgtatttccctgttaagtagttatt 4972368  T
250 tagtaatgattttaagatg 268  Q
    |||||||||||||||||||    
4972367 tagtaatgattttaagatg 4972349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University