View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6667_low_3 (Length: 390)
Name: NF6667_low_3
Description: NF6667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6667_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 35210329 - 35210674
Alignment:
| Q |
1 |
atgtgtatatgtattttctctcgaacgtccatgatagtcatcgttaacaaaagtccaactagtgatttatggttggcaagaggctatgaagggttgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35210329 |
atgtgtatatgtattttctctcgaacgtccatgatagtcattgttaacaaaagtccaactagtgatttatggttggcaagaggctatgaaggggtgataa |
35210428 |
T |
|
| Q |
101 |
atgaattttgttaaattcatagaaggtttatttgttaaggtggtctggtgcatagaaagatcaacta-gttcagttgagacatgatgcatctttcaaaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35210429 |
atgaattttgttaaattcatagaaggtttatttgttaaggtggtctggtgcatagaaagatcaactaggttcagttgagacatgatgcatctttcaaaag |
35210528 |
T |
|
| Q |
200 |
aagaaggatgtcttggagtaagaatttttcagtttt---tcaatgtataattgctatccaaatggctatgaaggtgcttcacaaattcaatttctatttc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210529 |
aagaaggatgtcttggagtaagaatttttcagtttttgatcaatgtatcattgctatccaaatggctatgaaggtgcttcacaaattcaatttctatttc |
35210628 |
T |
|
| Q |
297 |
gttcaggttacataatcatatgtatgacccgatattagaattgttg |
342 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35210629 |
gttcaggttacataatcatatttatgacccgatattagaattgttg |
35210674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University